Here is an interesting article (well it interested me!), scientists usually “publish” the results of their scientific experiments in specialist magazines called “journals”. The more “publications” a scientist has with their name on, the more successful they are. Some Professors with big laboratories can write 10 or more publications a year, a scientist working on their own will be doing well to get 1 or 2.
Anyway, a scientific publication is almost always a written article telling you what they have discovered. This paper published in a Breast Cancer Research Journal is interesting because it tells you what the scientists DON’T know. Your can read the html version or a pdf.
I bet you’re thinking, “well, it’s pretty obvious, we don’t know how to cure it”. That’s true, but how do you go about curing it? What do you need to know? This publication, looks at what we already DO know and what we need to find out.
Twelve scientists, from across the UK wrote this paper, two are working in Scotland (Dundee and St Andrews) the others are from England (Manchester, Sheffield and Bristol) and Wales (Cardiff).
1 Everyone agreed they needed to be better “preclinical models” that means, better ways of doing experiments before you test on human patients.
2They all agreed that doctors and scientists need access to “annotated clinical material”, that usually means samples of tumours (i.e. the bit they cut out when they do a biopsy and a bit of information about what type of tumour it is, the age of the women etc)
3 They all agreed there needs to be more “cross disciplinary working”. That means that scientists that work in labs on cells need to work with doctors in hospitals who treat patients. It can also mean that doctors and scientists work with radiologists, nurses, psychologists, specialist nurses to find the best ways of treating and helping those with breast cancer AND those at risk of developing the disease.
The paper then goes onto list some very specific things that scientists and doctors need to discover to help women with breast cancer, by that they mean to help to find a cure to breast cancer and to help people who currently have the disease cope with treatment. Are you ready? Here is the Science bit…
1 Genetics of Breast Cancer
We need to do find new ways of carrying out experiments to look at “epigenetic changes”. Those are changes to DNA that don’t affect the nucleotide sequence (the nucleotide sequence is a string of letters like “ATTCCTGGCTAATTCGCGATT”). Epigenetic changes don’t change the nucleotide sequence of a gene but they can affect if it is turned on or off. These are difficult experiments to do, especially on a large scale and by large, the scientists mean looking at hundreds of thousands of changes in hundreds of thousands of women!
2 Initiation of Breast Cancer
Scientists who study the “initiation” of breast cancer are studying how it starts. They say we need to do more research to study the genetic changes that happen in DCIS (ductal carcinoma in situ)
3 Progression of Breast Cancer
The progression of breast cancer involves studying how a tumour grows, gets bigger and spreads to other parts of the body. We need to do more research on biopsy samples to see how tumours change, especially after therapy. We also need to know more about the genetics of these samples, so does a tumour in a women with a BRCA1 mutation act differently to a women without a BRCA1 mutation?
4 Therapies and targets in Breast Cancer
We need better ways of studying which women are being helped by treatment i.e. “responding” and which women aren’t being helped. We also need better ways to detect “minimal residual disease”.
5 Disease Markers in Breast Cancer
A disease marker is a specific change that a scientist can look for in a lab. We need to find markers so we can tell which women will respond to therapy (e.g. chemotherapy or hormone therapy) and which women won’t. We also need to find markers in healthy women that might “predispose” (make them more likely) to get breast cancer.
6 Prevention of Breast Cancer
We need more work to look at the effect of diet and exercise on women AFTER they have been diagnosed with breast cancer and how this affect their quality of life. We also need better ways of predicting who will get breast cancer in their lifetime.
7 Psychosocial Aspects of Breast Cancer
Scientists need to do more work to make sure that the needs of older women and women from ethnic groups are being met. This might mean specialist support designed for certain women. We also need to scientifically measure ways of helping people cope (or in scientist speak “evaluate appropriate psychosocial interventions”)
Got that? It seems like a very long list. But there you have it, these are the things that doctors and scientists don’t know about breast cancer. The more this sort of research is funded, the better we will be able to help all women who are diagnosed with breast cancer.
If you are more impressed with the images than the text “
